|
New England Biolabs
vector plko 1 hygro for shrna Vector Plko 1 Hygro For Shrna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/vector plko 1 hygro for shrna/product/New England Biolabs Average 97 stars, based on 1 article reviews
vector plko 1 hygro for shrna - by Bioz Stars,
2026-03
97/100 stars
|
Buy from Supplier |
|
Addgene inc
plko 1 hygro vector Plko 1 Hygro Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko 1 hygro vector/product/Addgene inc Average 94 stars, based on 1 article reviews
plko 1 hygro vector - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
|
Millipore
shβcat; plko.1-hygro, target sequence tctaacctcacttgcaataat Shβcat; Plko.1 Hygro, Target Sequence Tctaacctcacttgcaataat, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/shβcat; plko.1-hygro, target sequence tctaacctcacttgcaataat/product/Millipore Average 90 stars, based on 1 article reviews
shβcat; plko.1-hygro, target sequence tctaacctcacttgcaataat - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Addgene inc
plko.1 hygro ![]() Plko.1 Hygro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko.1 hygro/product/Addgene inc Average 90 stars, based on 1 article reviews
plko.1 hygro - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Addgene inc
plko 1 hygro shtraf3 target cctgcttccttggccgtttaa grna ![]() Plko 1 Hygro Shtraf3 Target Cctgcttccttggccgtttaa Grna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko 1 hygro shtraf3 target cctgcttccttggccgtttaa grna/product/Addgene inc Average 96 stars, based on 1 article reviews
plko 1 hygro shtraf3 target cctgcttccttggccgtttaa grna - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
Addgene inc
lentiviral vectors ![]() Lentiviral Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/lentiviral vectors/product/Addgene inc Average 96 stars, based on 1 article reviews
lentiviral vectors - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
Addgene inc
plko 1 hygro ![]() Plko 1 Hygro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko 1 hygro/product/Addgene inc Average 98 stars, based on 1 article reviews
plko 1 hygro - by Bioz Stars,
2026-03
98/100 stars
|
Buy from Supplier |
|
Addgene inc
plko 1 vectors encoding shrnas ![]() Plko 1 Vectors Encoding Shrnas, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko 1 vectors encoding shrnas/product/Addgene inc Average 96 stars, based on 1 article reviews
plko 1 vectors encoding shrnas - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
Addgene inc
plko 1 plasmid ![]() Plko 1 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko 1 plasmid/product/Addgene inc Average 96 stars, based on 1 article reviews
plko 1 plasmid - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
Addgene inc
plko 1 neo vector control ![]() Plko 1 Neo Vector Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko 1 neo vector control/product/Addgene inc Average 94 stars, based on 1 article reviews
plko 1 neo vector control - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
|
Addgene inc
plko 1 cre lentiviral vector ![]() Plko 1 Cre Lentiviral Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko 1 cre lentiviral vector/product/Addgene inc Average 93 stars, based on 1 article reviews
plko 1 cre lentiviral vector - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Addgene inc
plko 1 shtgfbr3 puro ![]() Plko 1 Shtgfbr3 Puro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko 1 shtgfbr3 puro/product/Addgene inc Average 88 stars, based on 1 article reviews
plko 1 shtgfbr3 puro - by Bioz Stars,
2026-03
88/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Journal of Virology
Article Title: Digitoxin Suppresses Human Cytomegalovirus Replication via Na + , K + /ATPase α1 Subunit-Dependent AMP-Activated Protein Kinase and Autophagy Activation
doi: 10.1128/JVI.01861-17
Figure Lengend Snippet: Digitoxin fails to inhibit HCMV in ATG5 knockdown (KD) cells. (A) ATG5-deficient cells were generated using shRNA, and KD efficiency was confirmed by WB. (B) pLKO.1 control cells and ATG5 KD cells were infected and treated with digitoxin (30 nM), and bafilomycin A1 (50 nM) was added 4 h before harvest. The expression of LC3-II, p62, and ATG5 was detected by WB. (C) Control pLKO.1 and ATG5 KD cells were infected with HCMV TB40 at 200 PFU/well and treated with digitoxin or GCV in a 12-well plate. Plaques were counted after 10 days, and data are presented as means ±SD.
Article Snippet: The following sequences were used to generate Na + ,K + /ATPase α1 subunit short hairpin RNA (shRNA) and a nonsilencing (NS) control by cloning into the
Techniques: Generated, shRNA, Infection, Expressing
Journal: Journal of Virology
Article Title: Digitoxin Suppresses Human Cytomegalovirus Replication via Na + , K + /ATPase α1 Subunit-Dependent AMP-Activated Protein Kinase and Autophagy Activation
doi: 10.1128/JVI.01861-17
Figure Lengend Snippet: Digitoxin fails to induce autophagy or to inhibit HCMV in α1 KD cells. (A) Control and α1 KD cells were infected and treated with digitoxin (30 nM), AICAR (0.8 μM), digitoxin plus AICAR, or GCV. Levels of pp65, pAMPK, and p62 were detected by WB at 72 hpi. (B) Uninfected cells were treated with digitoxin or GCV. Levels of pAMPK and p62 were detected by WB. (C) α1 KD and control HFFs were infected with HCMV Towne (100 plaques/well), followed by treatment with digitoxin or GCV. Plaques were counted under each condition at day 8 postinfection. (D) (Left) Lysates from panel A were used to detect mTOR, p-mTOR, and the mTOR substrates p-Ser S6K and p-Thr S6K. (Right) p-mTOR levels were quantitated by densitometry. (E) pLKO.1 and α1 KD cells were infected and treated with digitoxin or GCV for 12 h. One-milligram aliquots of protein from the prepared lysates were used to pull down ULK1. AMPK, mTOR, and α1 were detected by WB of the input samples.
Article Snippet: The following sequences were used to generate Na + ,K + /ATPase α1 subunit short hairpin RNA (shRNA) and a nonsilencing (NS) control by cloning into the
Techniques: Infection
Journal: Nature cell biology
Article Title: A time- and matrix-dependent TGFBR3–JUND–KRT5 regulatory circuit in single breast epithelial cells and basal-like premalignancies
doi: 10.1038/ncb2930
Figure Lengend Snippet: TGFBR3 and JUND are functionally important for 3D morphogenesis. ( a ) Time-dependent expression of TGFBR3 during 3D morphogenesis . ( b ) Knockdown of TGFBR3 and inducible addback of murine RNAi-resistant Tgfbr3. TGFBR3/Tgfbr3 levels for cells cultured in the absence (Lane 1 and 2) or presence (Lane 3) of 1 µg/ml DOX for 24 hours were analyzed by immunoblotting. Hsp90 was used as a loading control. Densitometry of TGFBR3/Tgfbr3 abundance is shown normalized to the shGFP control. ( c and d ) Blocking TGFBR3 induction specifically elicits a ductal-branching phenotype. The MCF10A-5E lines described in ( b ) were placed in morphogenesis in the absence (control and shTGFBR3) or presence (Tgfbr3 addback) of 1 µg/ml DOX from day 4–10. Acini were fixed at day 10 of 3D culture, stained for E-cadherin (green) and HA-tagged Tgfbr3 (red), and analyzed by confocal immunofluorescence. Cells were counterstained with DRAQ5 (blue) to label nuclei. ( e ) Constitutive expression of HA-tagged JUND analyzed by immunoblotting. Densitometry of JUND abundance is shown normalized to pBabe vector control. ( f and g ) Constitutive JUND expression causes stable cribiform-like acinar structures. Acini from the MCF10A-5E lines described in ( e ) were placed in morphogenesis, fixed at day 28, stained for E-cadherin (green) and HA-tagged JUND (red), and analyzed by confocal immunofluorescence. Cells were counterstained with DRAQ5 (blue) to label nuclei. ( h ) Homogenization of JUND expression by knockdown of JUND and addback with murine RNAi-resistant JunD to near-endogenous expression levels. JUND/JunD levels were determined by immunoblotting. Densitometry of JUND/JunD abundance is shown normalized to the shGFP control. ( i ) Quantification of the cribiform-like phenotype at day 28 of 3D culture for the cells in ( h ). For ( a ), ( c ), ( g ), and ( i ), data are shown as the mean ± s.e.m. of n=3 ( a ) or n=4 ( c , g , i ) independent experiments. For ( d ) and ( f ), scale bar is 20 µm. For ( e ) and ( h ), tubulin was used as a loading control and n.s. denotes a non-specific band. For source data, see .
Article Snippet: pLKO.1 shGFP puro (Addgene #12273),
Techniques: Expressing, Knockdown, Cell Culture, Western Blot, Control, Blocking Assay, Staining, Immunofluorescence, Plasmid Preparation, Homogenization